Science topic

Genetics - Science topic

Genetics is a discipline of biology, is the science of genes, heredity, and variation in living organisms.
Questions related to Genetics
Tools for pathway analysis
Question
3 answers
Following websites contain usefull tools in your search for relevant pathways in your experiments http://babelomics.bioinfo.cipf.es/ http://bioinfo.vanderbilt.edu/gotm/ http://david.abcc.ncifcrf.gov/ http://bioinfogp.cnb.csic.es/tools.php http://vortex.cs.wayne.edu/ontoexpress/
Relevant answer
Answer
really useful ?
Question
6 answers
1 pepc/c4-0f ccgmggmsckccatggcgtc
2 pepc/c4-3200r atgccaagattttccacttggac
Relevant answer
Answer
Dear Marjan
Those primers can be called as Degenerate primers which can amplify more then one gene of same family or different family.
Question
2 answers
Hi everyone.
I'm doing some LD calcules between a SNP and HLA system. My doubt is if i have a negative value of D' for one allele and p>0,05, can i say that this allele is in LD with the HLA system or is in LD only the other allele that has the positive value?
Relevant answer
Answer
to have L.D you need r2 and D'>0.8 + P<0.05 !
Question
1 answer
I want to know the molecular mechanism of non- transcription/ non- translation of recessive allele. or if it so then why dwarf and such other charaters still exist when they have no proteins.
Relevant answer
Answer
Some recessive alleles are transcribed, but the resulting protein is different enough from the wild-type protein that it changes the phenotype. For example, in Drosophila, the white eye allele is recessive to the red eye allele; individuals that have a white allele still produce a protein from that allele, but the protein cannot function in its normal role, so the eye lacks pigment.
In other cases, mutations in promoter regions could prevent transcription, in which case you'd most likely have a recessive mutation due to lack of expression. This paper - http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1472899/ - describes a study of a particular recessive allele that affects disease resistance in rice that was traced to mutations in the promoter sequence, resulting in reduced transcription of the allele.
There could be (and probably are) a ton of other mutations that would alter transcription levels - mutations in cis or trans-acting regulatory elements, for example.
Question
15 answers
We are having a report about different genetic disorders and i am task to explain edwards syndrome...
Relevant answer
Answer
Trisomy 18 (T18) (also known as Trisomy E or Edwards syndrome) is a genetic disorder caused by the presence of all or part of an extra 18th chromosome. It is named after John H. Edwards, who first described the syndrome in 1960.[1] It is the second most common autosomal trisomy, after Down Syndrome, that carries to term.
Trisomy 18 is caused by the presence of three – as opposed to two – copies of chromosome 18 in a fetus' or infant's cells. The incidence of the syndrome is estimated as one in 3,000 live births.[2] The incidence increases as the mother's age increases. The syndrome has a very low rate of survival, resulting from heart abnormalities, kidney malformations, and other internal organ disorders.
Question
2 answers
I want to study the ACE gene polymorphism in horse, but i am not able to find any primer informations related to that.
Can anyone help me in detecting the polymorphism, i am trying to find out the InDel polymorphism of ACE gene like that in humans. am not sure about the presence of same polymorphism in horse because the research on this polymorphism is concentrated to humans. Now i wanted to extend it to the feild of veterinary....
If anyone having idea about the ACE-1 gene polymorphism in horse, please help me.
How to design a new primer for detecting the polymorphism in above said gene as the location of polymorphism or even its presence are unknown???
Relevant answer
Answer
Hey! Promd
"Primers
Since the equine ACE coding sequence was not available at the commencement of this study, primers were selected based on the aligned cDNA sequences of the human, rabbit, rat and chicken genes"
go to the link you get useful information
in the paper they mentioned that equine genome has similar structure to that of some known mammals, search in nucleotide and design the primers what you need.
Seems Marie also mentioned the same paper.
Question
23 answers
I'm waiting for your comments!
Relevant answer
Answer
Spectrophotometric methods often over estimate the DNA conc. Flourescent molecules that bind to dsDNA is a well used method that is supposed to be more accurate. For instance "Qubit", "picogreen".
Question
4 answers
The accumulated knowledge about chromosomal Q-heterochromatin polymorphisms in human populations inevitably raises, at least two questions: (1) why is there so mush redundant DNA in chromosomes of higher eukaryotes and (2) what is the role of the genome organization on cellular function? My opinion on this subject expounded at these papers:
Ibraimov А.I., Mirrakhimov М.М., Nazarenko S.А., Axenrod Е.I. and Akbanova G.А. 1982. Нuman chromosomal polymorphism. I. Chromosomal Q-polymorphism in Mongoloid populations of Central Asia. Hum. Genet., 60: 1-7.
Ibraimov А. I. and Mirrakhimov М. М. 1982. Human chromosomal polymorphism. III. Chromosomal Q-polymorphism in Mongoloids of Northern Asia. Hum. Genet., 62: 252-257.
Ibraimov А. I. and Mirrakhimov М. М. 1982. Human chromosomal polymorphism. IV. Q-polymorphism in Russians living in Kirghizia. Hum. Genet., 62: 258-260.
Ibraimov А. I. and Mirrakhimov М. М. 1982. Human chromosomal polymorphism. V. Chromosomal Q-polymorphism in African populations. Hum. Genet., 62: 261-265.
Ibraimov А. I. and Mirrakhimov М. М. 1985. Q-band polymorphism in the autosomes and the Y chromosome in human populations. In: “Progress and Topics in Cytogenetics. The Y chromosome. Part А. Basic characteristics of Y chromosome”. А. А. Sandberg (Ed). Alan R. Liss, Inc., New York. USA, pp. 213-287.
Ibraimov А. I., Mirrakhimov М. М., Axenrod Е. I. and Kurmanova G.U. 1986. Human chromosomal polymorphism. IX. Further data on the possible selective value of chromosomal Q-heterochromatin material. Hum. Genet., 73: 151-156.
Ibraimov А. I., Kurmanova G. U., Ginsburg Е. К., Aksenovich T. I. and Axenrod Е. I. 1990. Chromosomal Q-heterochromatin regions in native highlanders of Pamir and Tien-Shan and in newcomers. Cytobios, 63: 71-82.
Ibraimov А. I., Axenrod Е. 1., Kurmanova G. U. and Turapov О.А. 1991. Chromosomal Q-heterochromatin regions in the indigenous population of the Northern part of West Siberia and in new migrants. Cytobios, 67: 95-100.
Ibraimov А. I. 1993. The origin of modern humans: а cytogenetic model. Нum. Evol., 8(2): 81-91.
Ibraimov А.I, Karagulova G.О. and Kim Е.Y. 2000. The relationship between the Y chromosome size and the amount of autosomal Q-heterochromatin in human populations. Cytobios, 102: 35-53.
Ibraimov A.I. 2003. Condensed chromatin and cell thermoregulation. Complexus, 1: 164-170.
Ibraimov A.I. 2004. The origin of condensed chromatin, cell thermoregulation and multicellularity. Complexus, 2: 23-34.
Ibraimov A.I. and Karagulova G.O. 2006. Chromosomal Q-heterochromatin regions in individuals of various age groups. Int. J. Hum. Genet., 6(3): 219-228.
Ibraimov A.I. and Karagulova G.O. 2006. Chromosomal Q-heterochromatin variability in neonates deсeased during first year of age. Int. J. Hum. Genet., 6(4): 281-285.
Ibraimov A.I. and Tabaldiev S.K. 2007. Condensed chromatin, cell thermoregulation and human body heat conductivity. J. Hum. Ecol., 21(1): 1-22.
Ibraimov A.I. 2007. The evolution of body heat conductivity, skin and brain size in human. J. Hum. Ecol., 21(2): 95-103.
Ibraimov A.I. 2007. Genetic adaptation of man. In: Anthropology today: trends, scope and applications. Bhasin V, Bhasin MK, (eds). Kamla-Raj Enterprises, Delhi, India, pp. 513-523. Ibraimov A.I. 2008. On the pathogenesis of atherosclerosis: the role of the blood temperature, phase transitions of lipoproteins and turbulence of blood flow. J. Hum. Ecol., 23(3): 195-201.
Ibraimov A.I. 2008. Possible mechanism of the sex differentiation and its artificial regulation. Int. J. Hum. Genet., 8(3).
Ibraimov A.I. 2009. Noncoding DNAs and origin of sex. Int. J. Hum. Genet., 9(1): 39-47.
Ibraimov A.I. 2010a. Noncoding DNAs in Development and Evolution. In: MK Bhasin, C Susanne (Eds.): Anthropology Today: Trends and Scope of Human Biology. Delhi: Kamla-Raj Enterprises, pp. 199- 224.
Ibraimov A.I. 2010b. Chromosomal Q-heterochromatin regions in populations and human adaptation. In: MK Bhasin, C Susanne (Eds.): Anthropology Today: Trends and Scope of Human Biology. Delhi: Kamla- Raj Enterprises, pp. 225-250.
Ibraimov A.I., A.K. Kazakova, I.K. Moldotashev, M.T. Sultanmuratov and K.S. Abdyev 2010a. Variability of Human Body Heat Conductivity in Population. I. Methodological and Theoretical Approaches. J. Hum. Ecol. 32(1): 1-22.
Ibraimov, A.I., A.K. Kazakova, I.K. Moldotashev, M.T. Sultanmuratov and K.S. Abdyev
2010b. Variability of Human Body Heat Conductivity in Population. II. Diseases of Civilization.
J. Hum. Ecol. 32(2): 69-78.
Ibraimov A.I. Origin of modern humans: а cytogenetic model. Human Evolution, 2011, 26(1-2): 33-47.
Relevant answer
Answer
Yes, I am interested in collaboration. Send me detailes of your research program.
Question
1 answer
Dear colleagues,
I am looking for genetic studies on Pashtun tribes. While I can look in the published literature, I am wondering if there is a database of genetic information by ethnic groups that includes Pashtun.
Thanks,
Rolando
Relevant answer
Answer
Hello. As far as i know, the only record of the pathan ethnic group is in YHRD. http://www.yhrd.org
a single database of alleles in some pashtun groups can be found at
Question
6 answers
HI; I have the data of the molecular marker and the morphological traits, How can I find the QTL
thanks
Relevant answer
Answer
Hello. If you are good at programming, you can try R/QTL, which is basically a module of QTL in R Statistical environment. The tutorial for the same is http://www.rqtl.org/tutorials
Another very good and preferable method if you are not good at programming, is using a combination of QTL Cartographer: http://statgen.ncsu.edu/qtlcart/
Remember, there is no set method or protocol to carry out QTL Mapping. You will have to tweak both Tassel and QTL cartographer a bit and use both of them in conjunction to get desired results. It depends on how you wish to proceed forward, and how many traits and datasets you possess.
Finally here is a publication which will give you some idea on how to proceed with a QTL identification strategy:
Question
19 answers
A.g. studying during a month. Lectures and practice. Something like an express courses.
Relevant answer
Answer
I agree with Rupam, PCR and sequencing are just techniques. Pick up any textbook or even "google" the topics and you can read about the topics but to apply these techniques to a particular study, it is a different story. I find it is through trial and error in the scientific process of investigation that you really learn the technique while addressing a question. Why not kill two birds with one stone? I would chose a lab that heavily uses and relies on these two techniques if you really wish to learn.
Question
4 answers
What factors are important for editing?
Relevant answer
Answer
Hi, You can try the software Bioedit a free software available on line... Regards!
Question
5 answers
Hi; I would like to delete the entire sequence of a gene in a bacteria. If somebody has experience with this, Which steps and methods do you think are the best? Many thanks!!
Relevant answer
Answer
Well if you want to remove the entire gene the easiest way is to have duplicated restriction sites upstream and downstream of the gene. However this is difficult at best for a variety of reasons. A simpler method is whats is known as a suicide vector, where the vector carries homologous DNA to the flanking regions of the gene (or a large section of the gene) surrounding a resistance marker. You simply transform your host and the recombination event from the suicide vector will introduce the resistance marker in place of the gene. You then select for your deletion using a plate with the antibiotic you resisted against. This is just the basics, but as a teacher I don't like to spoon feed information. You should be able to figure out how to design a suicide vector with a few google searches.
Question
15 answers
1. I need the results for design the primer.
Relevant answer
Answer
Marjan, there are several tools (BioEdit, Dnasis Max) which help you to find regions with high homology. However, you also can do this via visual screening through the sequence alignment. I assume you know which region you want to amplify. In this sequence region you look for well conserved region.
If you design the primers, you should follow some basic rules:
1.) The length of a primer sequence should be around 20 bp
2.) The GC content should be around 50-55%
3.) The primer should end on the 3' end either with a G or a C
4.) The forward and reverse primer shouldn't be identical (very unlikely)
5.) The melting temperature of both primers should be roughly the same and should be around 50-60 °C
Good luck
Ijad
Question
14 answers
Hiiiiii for all......... Anybody can give me the sequence of tet(o) gene and tet(m) gene because i need it for primer preparation ?
Relevant answer
Answer
Sent
Question
10 answers
Any one can tell me what is the different between gene and genome ?
Relevant answer
Answer
Genome is the complete set of genes in an organism or haploid set of chromosomes where as gene is the segment of DNA which is responsible for the inheritable characteristics or any phenotype of an organism
Question
11 answers
hi for all There are 2 gene in streptococcus agalactiae called tet(o) gene and tet(m) .these gene resists tetracycline my question how it work ? any body know its sequence can any one help me?
Relevant answer
Answer
Molecular Characterization of Multidrug Resistance in Streptococcus mitis, Susan M. Poutanen, Antimicrobial Agents and Chemotherapy, June 1999, p. 1505-1507, Vol. 43, No. 6
Mechanisms of antibiotic resistance and tolerance in Streptococcus pneumoniae , Microbes and Infection
Volume 2, Issue 15, December 2000, Pages 1855-1864.
Question
4 answers
Dear Teachers/students,
I am presently engaged in a research project in Calcutta, India, after completing my master course in biochemistry.
I am going to address a serious topic here especially to higher ranked professionals and also to students of my category.
I understand the dearth of research collaboration all through out the world between the researchers individually or through institutes/universities. If the research works are shared more then I think science will progress at a much much faster rate.
Just like if two people share ideas among themselves, the gross idea of each individual increases and thinking of both rises to a higher level and have wider directions.
I know there are some important factors like secret of scientific works until published, publications, individual copyright etc needs to be considered while collaboration but isn't these points a bit cheaper in front of greater scientific progress? (giving due respect to existing regulations in scientific research).
It's not only just about collaboration relating a particular topic between two laboratories. what I mean to say is that can't the collaboration level rises to a higher level?
Can't research or for that matter papers or publications be created by/between researchers sitting far apart from each other but by sharing pieces of individual biological ideas, research works.
Isn't the pace of scientific progress slow? perhaps one of the reason may be lack of collaborations between researchers.
I think I have made my views pretty clear by now. I do not want the researchers to deviate from their original works but only want much more collaborations between the scientists performing similar research work. and more research being carried out and shared between individuals especially in the world where all can be easily accessible through world wide web, that is internet.
why can't a PhD scholar apart from doing his/her own work also contribute to/ collaborate through internet with other members to give rise to new work in similar or related fields?
My direct issue is that why can't groups of group members be formed and share their dry lab work or/and wet lab (as per time, conditions and infrastructure permits) together to give rise to new publications and thus contributing very faster to scientific world. Does it always need to be a part/member of same lab?
why can't an online laboratory be formed where the data of the experiments of individual researcher may be shared may be in a secret way and there is a guide supervising it and in the same way publications can also be made.?
I have written a lot.
I want views, discussions and suggestions from scientists as well as students about how this can be conducted efficiently and it's pros and cons.
Please write and suggest.
High Regards to all
Aditya Parekh
Relevant answer
Answer
Dear Aditya..
I like your views about collaborations and am happy to come forward in support of it. As I feel this will altogether increase the quality of research being carried out in India. I always felt researchers from china, US, and European countries collaborate more frequently and it is reflected in the quality of work and papers published.
But in India, the instances of people walking away with your idea are more frequent. First to have wider collaborations there should be trust factor developed between the researchers. One more way of doing it is to have clear cut demarcations in work do that nobody is left uncredited.
Will continue with this dicussion after seeing few more comments and views about this.
Question
3 answers
Relevant answer
Answer
This link also useful all of u cover topic "General Nucleic Acid Biochemistry" http://www.biochem.arizona.edu/classes/bioc461/Biochem461LectureNotes.htm
Question
7 answers
is there any other method to study proteome except 2DE?
Relevant answer
Answer
thanks
Question
4 answers
how can I keep blood for long time?
I want to keep whole blood for more than 2 months. is it possible?
Relevant answer
Answer
Use -20C refrigerator.. U can keep it over years if you have -80c facility
Question
5 answers
Hi everybody,
I have some basic doubts in genetics. They might be utter blunder, but I need to clear these things. It has been in my mind for a long time, but could not get anyone to answer them. Im posting the queries with the hope that somebody would clarify my doubts.
1. We know that two alleles of the same gene are present in a genome. Of them only one is active and expresses the protein. Now how is the other allele suppressed? What is the molecular mechanism behind it? Or how does the transcription machinery correctly identify the allele that alone has to be expressed?
2. It is known that if a parent is heterozygous, for eg. Hh then each of it will go to one of the gametes during the reproduction process thus forming half the number of offsprings with H & the other half with h. Take for eg in humans, if a parent gives birth to four children, how are the alleles correctly segregated between the four? In humans only one egg is formed at a time. In such case how does the segregation happen? Pls elaborate on the molecular mechanism behind this.
Relevant answer
Answer
Hi Shamya. I have a bias that in science there are no good answers just good questions. This is a good question so I will try my best to give you a good answer. First of all we now know that there are two genomes in higher cells (I can't remember who said this first I think Tony Linnane a yeast geneticist) the nuclear and the mitochondrial genomes ie the nuclear and the unclear. Your question only applys to nuclear genes. Although very iimportant in human genetics and modern biomedicine it is too complicated for this discussion so I will leave mitochondrial genetics to the mitochondriacs.
There are two copies of every gene in the nuclear genome of higher cells. One is often permanently inactivated usually by methylation (eg genes involved in fetal developmment) but can be "dearchived" under certain circumstances ( in cancers). In many homoallelic gene pairs both alles are expressed but are partially inactivated during parts of the cell cycle. Some genes turn themselves off or have natural antisense control elements and most are under the control of numerous transcription factors and have alternate splice junctions that give several different types of transcript -so the historical idea of Beadle and Tatum that one gene makes one enzyme in modern genetics is now only a partial truth. On top of that many genes are regulated at the translational level by other gene products and post translational mechanisms like phosphorylation or turned of by proteolysis. So in answer to your question there really isn"t a simple "on" "off" inactivation motif in cells. That is an old explanation and a first approximation to what we now know is a beautifully ochestrated system of gene expression in living cells.
Question
2 answers
Good day, I just want to ask a few opinion from others that can help me to solve my problem.
1. In my research study, I have 1 patient, after mutational analysis he had missense mutation and intronic polymorphism and another patient also same condition, he had missense mutation and exonic polymorhism. is it possible ? in my study we I analyze 26 exon.
Relevant answer
Answer
Ms Tan In order to help I think the group needs a little more information. By polymorphism do you mean simple restriction fragment length polymorphism (RFLP) and if so is the fragment bigger or smaller than wildtype on gels and what is the restriction enzyme being used. Second does the exon mutation change the amino acid that the triplet that it is within codes for and which aa is changed and to what? Thirdly does the intronic mutation affect RNA splicing or not? Lastly what is the condition and what is the gene in question?
Question
1 answer
It says in the net that girls are the one's commonly suffering edwards syndrome...but it does not tell why...
Relevant answer
Answer
Hi, Babylene Tubban,
Good article responding to your question is here:
Cereda A, Carey JC. The trisomy 18 syndrome. Orphanet J Rare Dis. 2012 Oct 23;7:81. doi: 10.1186/1750-1172-7-81.
It states:
“The prevalence (of Edwards syndrom – chromosome 18 trisomy) at birth is higher in females compared to males (F:M %, 60.4), but this discordance is not present if the sex ratio is calculated among fetuses electively terminated (F:M % 48:51.). Moreover the frequency of fetal loss is higher for males compared to females. Furthermore, liveborn females showed better survival compared to males.”
Question
12 answers
Back ground: I decide to transfer Gene related to Saccharum officinarum into the other plant and then express.
Then I just need ORF .I should design the primer for the first step after extracting RNA
I know this information:
AJ293346.1
gene 1..3067
gene="PEPC"
CDS 1..2886
The questions are:
1. Can I design only the pair primer which start from the first and end of ORF and make the specific sequence ( 2886 bp) or regarding to the length (2886 bp) I have to divide the sequence in three locations and then design primers at least with three ones . With considering which I finally have to transfer and express this mentioned length, is it right make 3 steps for my work with three primers or I have to make just one pair primer for this mentioned length.
2. With considering that gene and CDs start in the same location as I mentioned in back ground. If I start exactly from ATG in the start of the CDs, I cannot design a proper primer! The question is it:
1. Start of primer with ATG does not make problem?
2. If I decide to find around 50 mRNA nucleotide before the ATG of the ORF, but it is not mentioned in Gene sequence, how can I find by the whole genome sequence of sccharum officinarum. I know that the whole genome of saccharum officinarum has identified( Asano T, 2004), but I do not know how I look for 50 nucleotides before the ORF of the gene of interest.
Relevant answer
Answer
If you are looking to express this gene into the host plant don't forget you are going to need a plant based promotor system. Merely cloning the gene is worthless if you are looking for gene expression. This isn't as hard as it sounds, there are plasmids out there for Agrobacterium that have multiple cloning sites (MCS) with the tra genes needed for Agrobacterium infection.
In this case you will need to match your restriction sites in your PCR product to the MCS of the plasmid. You will also have to take step to make sure the 5' end of the gene is in step with the 3' end of the promotor for the proper reading frame.
Karyology
Question
2 answers
Is there anyone who could share his/her experience of Giemsa C-Banding Technique?
Relevant answer
Answer
yup i performed c- banding several times, you can find protocols for c banding on net just by typing centromere banding, its very easy to perform !!!
Question
30 answers
Hello All, I am now working to clarify some genes function of a microorganism. The genes is supposedly to encode a transcripional activator. It is a DNA-binding protein. However, deletion of these genes reveal some interesting phenotype. It is not just act as an activator but also repressor of transcription of some genes. It might be an indirect effect but it is unusual and difficult to withdraw any conclusion. So if anyone have any knowledge/reference about this matter, please do reply to this post. Thank you very much.
Relevant answer
Answer
In Escherichia coli, 40% of the transcription factors regulate in dual mode. I have classified these regulators in three different types: 1) those that can be activators in some promoters, and those that can be repressors in other promoters e.g CysB; 2) those that can activate and repress the same promoter (with more than one DNA binding site) e.g. AraC; and 3) those that can activate and repress the same promoter in the same DNA binding site e.g., ChbR (although there is a little reference about this).
Question
3 answers
If it is possible, which enzyme is using for that..?
Relevant answer
Answer
Yes, you can end label DNA. However, remember that this procedure is used for short fragments because you can add only one label per molecule as compared to random labeling. For end labeling, you have to use T4 polynucleotide kinase along with gamma 32P. Here the last phosphate (gamma position) of 32P is isotopically labeled. This labeled phosphate is transferred to the end of DNA molecule.
Question
8 answers
dear friends i got a new confusion in doing PCR.. the company i ordered for a primer gave Tm value as 62.6'C.. but when i blasted the primer it gave 52.56 in NCBI.. which one should i follow.. i dont know the annealing temperature.. please help me in this
Relevant answer
Answer
You don't believe either of them..u calculate manually by using 2(AT) + 4(GC). Then u put gradient PCR such that the gradient temperature should cover 4 degree lower as well as 3 degree above from the calculated Tm. For ex. if the calculated Tm is 62 the ur gradient range should be 58-65. Let me know the result. Even though u face the problem u can opt for Touchdown PCR.
Question
8 answers
I have lost a label of an eppendorf tube but I don't know what is it : RNA or DNA? what should I do ? I want the cheapest technique, can I use the spectrophotometer? if yes how?
Relevant answer
Answer
If you have Agilent 2100 Bioanalyzer (or any other company bioanalyzer), u can distinguish betweeen RNA and DNA. The absorbance will not be promising.
Question
12 answers
I know breeding is done for disease resistance... How certain genotypes are related to resistance.. What does these genes do??
Relevant answer
Answer
Genes can be related to disease/drug resistance in many ways. A certain genotype can express a higher or lower number of a certain protein which is related to the disease. This protein could be any carrier, receptor or immunoglobulin, for example :)
You could imagine the gene X, that codificate the protein Y, which is implicated in the building of a T cell weapon against some kind of virus...
Question
3 answers
i heard that the lincoln university scientists developed a rapid DNA test to identify the strain of dichelobacter nodosus.. what is the protocol of the test??
Relevant answer
Answer
Sorry I do not have exact information.
Question
2 answers
Hello, I don't understand the nomenclature of the microsatellites locus, for example D7S13, the D= DNA, 7= chromosome 7, but the S13 ? what does it refer to?
Best Regards
Sahar Taamalli
Relevant answer
Answer
The following guidelines determine each part of the symbol
Part I: D for DNA
Part II: 0,1,2,...22,X,Y,XY for the chromosomal assignment, where XY is for segments homologous on the X and Y chromosomes, and 0 is for unknown chromosomal assignment.
Part III: A symbol indicating the complexity of the DNA segment detected by the probe, with S for a unique DNA segment, and Z for repetitive DNA segments found at a single chromosome site or F for small undefined families of homologous sequences found on multiple chromosomes. Part IV: 1,2,3,..., a sequential number to give uniqueness to the above concatenated characters.
Part V:When the DNA segment is known to be an expressed sequence the suffix E can be added to indicate this fact.
cited from: GUIDELINES FOR HUMAN GENE NOMENCLATURE (1997).
What is the role of autosomal genes in male infertility?
Question
2 answers
Relevant answer
Answer
Thank you dear Jorg. the second article seems to be very interesting to me as it gives a clue for my next project.
Question
1 answer
I'm trying to write a proposal on a study to determine possible association of a polymorphism to the occurence of essential hypertension in a specific population. How do you do that? I tried using a program "Quanto" but I really don't understand what the meaning off odds ratio is. Hahah sorry I'm kinda lost.
Relevant answer
Answer
If you are planning to study the association of genetic polymorphism in a specific population the minimum sample size required is 300/500 patients and equal no of controls. odds ratio you can calculate withthe help of odds ratio calculator or openepi software available online. which plays an imp role in logistic regraseeion analysis.
Question
11 answers
Another way to ask the question is: what is the frequency of nicks and double strand breaks in human DNA in vivo?
Relevant answer
Answer
Hi Mark,
I'm not entirely sure if this will answer your question, but feel free to drop me a line if you
wanna specify your question.
As you most certainly know, the DNA in human cells undergoes numerous damaging
events each day caused by exogenous (radiation such as UV-light, toxins) and endogenous
(e.g. radicals derived from cell internal metabolism) processes. It is hard to put down an exact
number and even harder to exactly differentiate between nicks and double-strand breaks (DSBs),
but it is estimated that about 2*10^4 DNA damaging events occur per day in each cell. (1)
In the literature the numbers normally vary between 10.000 and 40.000 events per cell per day. (e.g. 2, 3, 4)
Most likely, the major part of these DNA damage events results from endogenous sources such as
reactive oxygen species (ROS). (5)
Although it is said that DNA damage can occur at any time on any genomic location, the distribution of
e.g. DSBs across the chromosome might be dependent on the cell cycle stage, since the chromatin
structure undergoes major changes during the cell cycle. Certain regions might be better protected
due to protein binding while highly condensed regions might on the other hand be less accessible for
DNA repair and might require restructuring. (6,7) The amount and region where DNA damage occurs might
therefore vary.
More about random/non-random distribution of DSBs across chromosomes can be found in: (8)
In general, DNA damage events are a stochastic process, which is also reflected in the fact that one uses
significantly different doses of radiation to cause e.g. radiation induced DNA-damage and the resulting effects
in model systems with different genome sizes.
The radiation doses used in Radelegans (specific C. elegans model for radiobiology research) to produce vulval malformations (100-400 Gy) are approximately two logs higher than those typically used to study biologic responses
in mammalian cells (0.5-10 Gy). The need for higher dose levels in C. elegans is consistent with the observation that
the dose required to produce a given biological effect in eukaryotic cells is inversely related to the size of the genome. (9, 10)
Best,
Dan
(1) Ames B., Shigenaga K. (1992) Oxidative stress is a major contribution to aging. Ann NY Acad Sci 663:85–96.
(2) De Bont, R., and van Larebeke, N., Mutagenesis, 19, 169-85 (2004).
(3) Lindahl, T. and Nyberg, B., Biochemistry, 11, 3610-3618 (1972).
(4) Ames B N and Gold L S. Endogenous mutagens and the causes of aging and cancer. Mutation Research
250(1-2): 3-16, Sep-Oct 1991. “A very large oxidative damage rate to DNA occurs as part of normal metabolism.
In each rat cell the steady-state level is estimated to be about 10exp6 oxidative adducts and about 10exp5 new
adducts are formed daily.”
(5) Jackson, A.L., and Loeb, L.A., Mutat. Res., 477, 7-21, (2001).
(6) M. Spotheim-Maurizot, M. Davídková, Radiation damage to DNA in DNA–protein complexes,
Mutation Research/Fundamental and Molecular Mechanisms of Mutagenesis, Volume 711, Issues 1-2,
3 June 2011, Pages 41-48, ISSN 0027-5107, 10.1016/j.mrfmmm.2011.02.003.
(7) Martijn S. Luijsterburg, Haico van Attikum, Chromatin and the DNA damage response:
The cancer connection, Molecular Oncology, Volume 5, Issue 4, August 2011, Pages 349-367,
ISSN 1574-7891, 10.1016/j.molonc.2011.06.001.
(8) Rainer K. Sachs, Artem L. Ponomarev, Philip Hahnfeldt, Lynn R. Hlatky, Locations
of radiation-produced DNA double strand breaks along chromosomes: a stochastic cluster
process formalism, Mathematical Biosciences, Volume 159, Issue 2, July 1999, Pages 165-187.
(9) Kaplan, H. S. and Moses, L. E. Biological complexity and radiosensitivity. Radiation
lethality in cells and viruses is correlated with nucleic acid content, structure, and ploidy.
Science, 145: 21-25, 1964.
(10) Sparrow, A. H., Underbrink, A. G., and Sparrow, R. C. Chromosomes and cellular radiosensitivity. I.
The relationship of D0 to chromosome volume and complexity in seventy-nine different organisms.
Radiation Research, 32: 915-945, 1967.
Question
1 answer
Unknown transcripts
Relevant answer
Answer
1, translate your cDNA sequences into protein by trying 6 reading frames;
2, use Interproscan (http://www.ebi.ac.uk/Tools/pfa/iprscan/) to annonate the functional domains of your proteins for the functional prediction.
Question
4 answers
Question:
The freedom degree (df) number should be 1 or 2? when we analysis the distribution of certain gene's genotypes frequencies between case and control group by Chi2 test. As the following table:
genotype frequency
AA AB BB
case 201 335 45
control 230 321 30
chi-square was 5.25, and the p value=0.0725 given df=2. But the p value will <0.05, when df=1.
Relevant answer
Answer
It`s easy to use the number of allele/haplo minus number of classes. With 3 genotypes and 2 alleles the df is 1. Greetings!
Question
1 answer
Isovaleric acidemia (IVA) is a rare disorder, classified as an organic acid disorder. Mutations in the IVD gene cause IVA.
Relevant answer
Answer
If you follow this link, you will find 189 highly specific and most recent articles on the subject. http://eutils.ncbi.nlm.nih.gov/entrez/eutils/erss.cgi?rss_guid=14k4RBOiMM0i1V6gYSwopeW-vYP9UeuAIMc29SV3H-QrSnlsYf
Below are some of them.
Bests
Rolando
Isovaleric acidemia.
Pascarella A, Rosa M, della Casa R, Andria G, Parenti G.
J Pediatr Endocrinol Metab. 2011;24(5-6):399. No abstract available.
PMID:21823546[PubMed - indexed for MEDLINE]
2.[Isovaleric acidaemia--a rare and serious defect in the metabolism of leucine].
Lund AB, Lund AM.
Ugeskr Laeger. 2011 Apr 11;173(15):1121-3. Danish.
PMID:21672462[PubMed - indexed for MEDLINE]
3.Memories of a great man, Ivan Málek.
Demain AL, Spizek J.
J Ind Microbiol Biotechnol. 2010 Dec;37(12):1223-4. No abstract available.
PMID:21086096[PubMed - indexed for MEDLINE]
4.Maternal isovaleric acidemia: observation of distinctive changes in plasma amino acids and carnitine profiles during pregnancy.
Castelnovi C, Moseley K, Yano S.
Clin Chim Acta. 2010 Dec 14;411(23-24):2101-3. Epub 2010 Aug 31.
PMID:20807522[PubMed - indexed for MEDLINE]
Question
1 answer
Linkage based QTL mapping is one of the hot topic now adays.
Question
2 answers
Hi , I am an assistant professor in the dept of Orthodontics in a central university in India. I am noticing an increased incidence of cases of impaction in the population we are serving here. I would like to do a genetic study on the genes responsible for impaction. What is the kind of study I should plan ?
Relevant answer
Answer
The etiology of dental anomalies is partly environmental and partly genetic. Because of the polygenic nature of dental characteristics, it is very challenging to identify one single defective gene responsible for a specific dental anomaly. However, recent studies provide new data about the candidate genes. Further studies are required and the rapid progress in the field of genetics may help the clinicians to more accurately discern the environmental and genetic factors contributing to the development of dental anomalies. Currently, the orthodontist, probably the first to diagnose hereditary dental anomalies and malocclusion of an individual, will remain responsible for the detection of any additional defects in the same patient in order to provide the best treatment. The clinician should always keep in mind that some of those dental anomalies can coexist with certain syndromes and other family members might also have been affected. Whenever it seems necessary, a genetic consultation should be added as part of the orthodontic treatment. Finally, this interdisciplinary approach may help to reveal any risk of recurrence in subsequent generations.
Question
2 answers
which one easier? using mtDNA or microsatellite?
and can you give me reason why?
Relevant answer
Answer
Maybe this article (and maybe contacting the author) might help you as well: http://jhered.oxfordjournals.org/content/102/4/391.abstract
Question
2 answers
Psoriasis curable or not ??? any treatment??
Relevant answer
Answer
Sunil Naidu wrote:
> Psoriasis curable or not ???
A couple of days ago, the molecule dimethylfumarate has been identified as
possible treatment. Disclaimer: I'm no medic.
Regards,
Joachim
Question
22 answers
Hi,
I was wondering if anyone knows a database or any other resource where I coud find which isoform of a gene expressed in which tissue. For example, I am looking into OPRM1 gene which has 13 isoforms and I would like to know which ones are expressed in the brain and which are not. I've tried to look at GEO information in NCBI, but I am fraid I know too little to understand it. Any suggestions? Any idea/help would be greately appreciated!
Many thanks,
T
Relevant answer
Answer
I had the same problem with the original question, and I have found the perfect database. Maybe somebody else would need it, so here is the answer: www.gtexportal.org 
It is a very good website for gene expression. Enter your gene of interest in the provided space. From 'Plot', select 'Isoform' but not 'Gene'.  Then, select your isoform of interest and you will see the graph below with expression levels is changing. You can even click on a specific tissue to see the difference between levels of expressions of different isoforms.
Question
12 answers
Recombinant DNA is utilized to alter gene expression such as for genetic disorders. Has it been considered as a cloning technique to replicate the entire organism?
Relevant answer
Answer
In case of replicate the entire organism, maybe you can read an article by Science about first synthetic bacteria, the work of J.Craig Venter. His team designed and synthesized whole genome of a bacteria and used it to transform target bacteria and it worked, the bacteria is controlled solely by the synthetic genome. So, it is a start but still a long way to go to be applicable for higher organisms...
Question
2 answers
Genes can transfer the informations to second progeny but how..............
Relevant answer
Answer
genes are basically particular sequence of nucleotides that coiled around histones (protein) to form a complex structure that is called DNA. this DNA replicates before the cell divide so when cells divide each cell will have DNA (genes) in it.
Germ cells that contribute to next generation are produced during meiosis, these germ cells also contain DNA in it so this DNA (GENES) will pass to next generation.
Question
4 answers
DNA make the copy of self to new generation ........... but how
tell me in brief
Relevant answer
Answer
DNA is a double stranded molecule and both strands are complementary to each other, when DNA has to make copies of itself these 2 strands get separated and each strand start synthesizing its complementary strand with the help of different enzymes.
Newly synthesized strand would be same as that of the strand which was separated before............ this process is called as DNA replication which helps DNA to make copies of itself.
Question
6 answers
I designed a primer with high Tm temperature (74, 70)
[I could not find a better primer. In addition, before PCR, I have to do RT-PCR to convert RNA to c DNA]
1. What kind of PCR do you suggest me? Is TD-PCR proper?
2. If yes what temperature would you recommend for star of gradual decreasing of temperature?
Thank you
Relevant answer
Answer
Hi Marjan,
if you own or have access to a gradient cycler you could try to narrow a working Tm. Otherwise you would have to set up several reaction ran at different temperatures. Try a range between 60-70 °C. I have not tried a TD-PCR but had a comparable primer pair. The solution was to run a program as follows:
initial denaturation: 96 °C 4 min
denaturation: 96 °C 45 s
annealing: 70 °C 75 s
elongation: 76 °C 60 s/kb
final elongation: 76 °C 2 min
I used DeepVent from NEB for this purpose. I hope this helps!
Alex
Question
6 answers
Hi Friends!!
I'm doing my final yr M.Tech biotech at PSG tech, Coimbatore. Can anyone please suggest me a nice project? It can be GE+bioinfo or GE+bioprocess (fermentation).... I believe my college lab has enough facilities for these.....
Awaiting eagerly,
Banu
Relevant answer
Answer
one yr boomi! equipment availability is good... nothing to complain..... but skilled personnel in fields like marker and stuff are not here:(
Alopecia
Question
3 answers
Hello everyone! I am looking for latest review article on Congenital Alopecia. Article must contain information on all known Loci and Genes reported for the disorder so far. Please share the aricle or link to the article if any one of has gone through one. Regards
Relevant answer
Answer
Check the OMIM catalog for congenital alopesia, it contains an updated review on its genetics PALMOPLANTAR KERATODERMA AND CONGENITAL ALOPECIA, AUTOSOMAL RECESSIVE http://www.ncbi.nlm.nih.gov/omim/212360
sophomore is in need
Question
2 answers
wanna find a USRP in EU for summer,2009,I dont want to waste my next summer with part-time jobs.
Relevant answer
Answer
what kind of subjects are you interested in? and which countries?
Question
1 answer
i wish you happy,full of joy and a wonderful new year 2010 to all of scienctific community
Aslam buzdar
Relevant answer
Answer
Happy new year
Question
6 answers
hi everybody i m new in this grp
Relevant answer
Answer
Tonsilitis is an infection. It is not genetic
Question
1 answer
On the genetics of general intelligence (IQ): In the ResearchBLOG you can read a small review, which should be of interest to geneticists in general, see http://blog.shootingcupoche.com/masterblog/830_MicroRNA_trinucleotide_repeats_and_the_genetics_of_general_cognitive_ability_IQ
Which group has the possibility to initiate research in this direction?
Relevant answer
Answer
Volkmar, great article! What do you mean with group? Do you mean group within researchgate? Maybe it makes sense to create a new one for that research area.
Question
1 answer
Hai,
If there is any possible to counting of tiger population in Camera Trap Method?
if "yes" means tell how?
if "No" means tell why? then tell which method is more suitable for counting of Wild Tiger population ?
Relevant answer
Answer
I do not know what Camera Trap Method is. In my country there is a group of researchers that collected feces of bears and they isolated DNA from it. After collecting the feces for quite some time they got a rough estimate of distinct number of bears in our country. Maybe this helps.
gg
Genetics doesn´t explain what is Life
Question
38 answers
As a philosopher, I must be very critic with genetist. They boast their descriptions of the DNA and the gens explain what is Life. I disagree. Genetists only describe thousands of parts of the DAN but they don´t know what is Life. More on this in the group "IS and Ought" of " philosophy".
Relevant answer
Answer
As a geneticist, it am a bit confused in your rationale, considering you do not make a counter argument. More importantly, you are over simplifying - "Life" - and over generalizing - "they boast" - to incorrectly assume all geneticists think the same way. So what is your point?
Question
3 answers
Hi, i am a veterinarian majoring in animal breeding & genetics, i am planning to perform genetics characterization of wild herbivores in central india, somebody please if can help me in this topic. I need references for it that could be quoted in my research thesis ...
Thanx
Relevant answer
Answer
Hi, well if u can please elaborate, i may help u out. Basically i am working on Genetic characterisation using molecular marker.
Question
1 answer
I am Kumaraguru working has PDF in tiger population estimation in India project
Relevant answer
Answer
Hai i am basically wildlifer there after only my research. If any one interested to join with me has a discussion partner regarding ecology, ecosystem, large carnivores(tiger, leopard, Dhole, hyena, etc), veetation regarding (analysis,habitat alteration, manmade disturbances, etc). i am ready to discuss with u always
Question
6 answers
Hallo,
I am working on dna activity. I need a enzyme that is as slow as possible. I have enzyme which is 500b/min. Is there any thing more slower?? or how can i slow down ezyme activity...
if someone has enzymes which work slower, i can test them too on lot of templates that i have..any help and suggestions are welcome
Relevant answer
Answer
So you are getting errors in your transcript... Are you just trying to do normal PCR with commercial Taq? What enzyme are you using?
Question
12 answers
i have one question
if some one has discovered a new multicellular organism and he wants to do genomic research but nothing is know genetically before what should be the steps/scheme for starting the research.i mean how can he take his frist step for a long journey to develop its genomic research/genome.
i need to know what should be the plan carry on the genomic study etc please let me know steps one by one
regards
ASLAM
Relevant answer
Answer
if you have Next Generation Sequencing technology, then everything will be easier. Can refer to 454 sequencing and ABI Sequencing.
Question
1 answer
hapy new year
Relevant answer
Answer
HAPPY NEW YEAR TO ALL ,,, WISHING YOU 2010 FULL OF JOY,,, SUCCESS & HAPPINESS
Question
2 answers
am wishing you a happy , colourful and successful new year to all
sarah
Relevant answer
Answer
Happiness deep down within.
Serenity with each sunrise.
Success in each facet of your life.
Family beside you.
Close and caring friends.
Health, inside you.
Love that never ends.
Special memories of all the yesterdays.
A bright today with much to be thankful for.
A path that leads to beautiful tomorrows.
Dreams that do their best to come true.
Appreciation of all the wonderful things about you.
Best Wishes
Saqib
Question
2 answers
hi everyone
Relevant answer
Answer
welcome Deepika Awasthi!
Question
2 answers
Hi i have been working on genetically modified plants. we are trying to develop PCR based detection techniques. i have doubt that why endogenous gene is giving more intense band than trans gene even though both are at same copy number in genome?
endogenous it is naturally present in the plant but trans gene is the gene inserted in to the plant artificially but i have taken 100% GM sample means at which both genes are in 1:1 ration in the genome more over i have been amplifying both the genes at same anealing temperature but why i am getting more intense band with endogenous gene only? please give me your answer........ i am eagerly waiting for your answer..
Relevant answer
Answer
Dear Vijay kumar, I need some more clarity about that endogenous gene and incorporated genes
1, Both genes are same ?
2, If both genes are not same I am suggesting to you, go for a gradient PCR b'coz here u mentioned u are using same annealing temp for both genes, If both genes and primer sequence is same u can use it otherwise annealing temp alters with sequence of gene and primer.
3, Which type of GMO plant it is ? means monocot and dicot ?
4, Normally for getting 100% genetic purity we are using self ,how it is established ?(through self pollination or else ?)
Question
7 answers
i need follwing paper if some one can send it to me i have no access of it.if possible please download and attach to my email
Purification and partial characterization of an exo-β-glucanase from the yeast Kluyveromyces aestuarii
by Marc-André Lachance, Tomas G. Villa, and Herman J. Phaff
Biochem. Cell Biol. 55(9): 1001–1006 (1977) | doi:10.1139/o77-149 | © 1977 NRC Canada
Relevant answer
Answer
thanks friend i got it. it is good idea ever
to share exchange of paper here
Beginer
Question
4 answers
Dear all, I am a beginer of genetic student. I hope to get the basis of genetic study and hope you all could help me, Sincerely
Relevant answer
Answer
Dear all, I am a begining of genetic student. I hope to get the basis of genetic study. I wish you all could kindly guide me. Thanks Ly TRY
Question
6 answers
Asalam O alikum Hi friends Please disscuss the reasons why we all human beings differe from each other, though we have almost similar genome at exon level and produces phenotypic differnces in all of you..?
Relevant answer
Answer
hi
as you know our more than 85% gemone has introns an only about 15% make our millions of deffferent protiens than only minute amount of difference can make different phenotypes and also go likns give above will help you more
Question
4 answers
Hello. Im experienced in reverse dot blot hybridization method in CFTR gene mutations detection. can I help u?
Relevant answer
Answer
This technique uses biotinilated PCR products for simultaneous hybridization with several normal and mutant probes specific to known mutations fixed on Biodyne C membranes.
Question
2 answers
Hi friends, we are in a group related to the most beautifull branch of science. Hope we will enjoy a lot, disccusng about it
Relevant answer
Answer
Hi to y'all..
I definetly like and enjoy genetics. To read it, trying to understand it. It's beautiful as it's the future..:)
New comer
Question
1 answer
I am a dental student, but i'm also interested in DNA. hope all members help me.
Relevant answer
Answer
I'm a dental student in Phnom Penh city, Cambodia, I'm intersted in DAN too. hope all member keep me up-to-date. thank
Northernblot
Question
4 answers
Hi everybody!! I am having a very stupid problem but i cant get a logical cause. It is the first time i set up a northernblot and somehow is not working at all. I am working with RNA from S. coelicolor M145. The method i am using is northernblot by capilarity because on my lab we dont have any machine to blot. My specific problem is that i can not transfer the RNA from the agorose gel to the membrane. I already tried to let the blot longer, with more buffer, with more weight, but nothing is working. The RNA agarose gel is made with formaldehide. The buffer i use to blot is the SSC 10X (NaCl 1.5 M, and Sodium Citrate 0.15 M). Do you have any idea about what is happening?, Do you know if i have to make any other treatment to the RNA, or to the RNA agarose gel before blotting?......PLEASEE HELP!!!!....I will be really glad for your answer.
Relevant answer
Answer
you need to confirm that there is intact RNA in the gel. you can do so by including ethidium bromide in the gel and checking for UV fluorescence. It is also useful to soak the gel after electrophoresis in the 10X SSC for 10 minutes before beginning the capillary transfer. You should also pre-soak the membrane in the buffer for several minutes. RNA transfer can take up to 12 hours even when done well. you should also rinse the membrane with a lower buffer concentration before attempting hybridization, e.g. 2X SSC. Finally, you should check on the possibility of RNase contamination of the reagents and/or use RNase inhibitors.
Question
1 answer
Plant Biology 2009
Joint Annual Meetings of the American Society of Plant Biologists and the Phycological Society of America
July 18-22, 2009 Hawaii Convention Center, Honolulu, Hawaii
Relevant answer
Answer
That is free charge or not?
Can scientific data be art?
Question
2 answers
I wanted to inform you of a gallery for science-related images: http://www.myartinscience.com/ Come and share your images from your research... you would be surprised how beautiful people think they are! Note: these images are not altered to look beautiful... its pure science! .. it just happens to be beautiful :)
Relevant answer
Answer
Given that nature itself is the origin of much art, it should stand to reason that science, the study of nature, should also yield a great deal of art as a latent function of the work. We have adorned a few halls of the building in which I work with SEM and FM images. They are some of the most beautiful images I've ever seen, irrespective of their origin (that they were initially captured for science rather than aesthetics). These images in many cases are as powerful as massive panoramic landscape, as they reflect the beauty of a normally unseen perspective. They are worthy, in some cases, of being hung in an art gallery.
Question
1 answer
Hi everybody, I am new in this group
Relevant answer
Answer
Welcome
Question
2 answers
hi everyone
Relevant answer
Answer
Who else likes such nonsensical comments, too?
Question
2 answers
i need some information about ITS1 SEQUENCES .... if anyone have any literatures about this subject plz would you share it with me...
Thank u in advance
Relevant answer
Answer
Dear Asma, you can get sequence of ITS1 from gene bank database for your further process. But please clear your need in good way. Then any person can help you. Thanks
Question
1 answer
Over 600 genes have been implicated in schizophrenia, subscribing to the idea of "multiple genes of small effect". These genes can be related to each other and together etch out signalling networks that are very relevant to the disease, as can be seen at http://www.polygenicpathways.co.uk/keggszgenes.htm
Pathway analysis of GWAS studies is very much in vogue and this type of analysis can be very useful in deciphering the genetic jumble.
Relevant answer
Answer
There is just a new publication looking at GWAS data for schizophrenia, Arnedo et al., Am J Psychiatry 2014 Sep 15. doi: 10.1176/appi.ajp.2014.14040435. [Epub ahead of print]
 Uncovering the Hidden Risk Architecture of the Schizophrenias: Confirmation in Three Independent Genome-Wide Association Studies.
This might help to decipher the genetic jumble.
Question
2 answers
Can u pls tel me where to find the list of all trangenic mice for informations.
Relevant answer
Answer
You can find out if for a given gene there is any trangenic/KO mice available at MGI website -
Question
2 answers
can anyone suggest me the way to identify the Plasmodium spices of rodents ( Berghei, Yeolii etc)??
if the methord is by use of PCR then it can not be better than that.
Relevant answer
Answer
Mr. Vikky, you are welcome regarding your request. Please explain your question and 2nd what is your major objective? please clear it.
As I understood from your question you want to Identify the Plasmodium in different species of rodents like you have mentioned as above.
Dear you need whole sequence of Plasmodium genome/ or sequence of any gene of Plasmodium, then you will design primers, then by using those specific primers you will make a PCR reaction for their identification.
insertion/deletion polymorphism of named repetitive element
Question
2 answers
Dear colleagues, may anyone tell me what do the insertion/deletion polymorphism of named repetitive element means? i could not find any specific explanation.
Relevant answer
Answer
thx Prabhakar for the explanation i'll check the link also
Question
4 answers
Does anyone know of a program that can predict how single stranded DNA will fold? I'm trying to design a DNA probe that will fold into a particular structure, primarily held by intra strand base pairs.
Relevant answer
Question
2 answers
What could be the reason for Multiple beta-lactamase in single genome
Relevant answer
Answer
I have seen this in S cerevisiae strains because of gene amplification caused by treatment with genotoxic drugs.
Question
3 answers
Whats a chromosome made out of?
Relevant answer
Answer
That's a very precise definition. thank u very much.
evoution of snakes
Question
1 answer
I would like to know how can I study evolution poisonous and non poisonous snakes? is anybody know about this?
Relevant answer
Answer
hi... may this this will spread light on your question http://arachnophiliac.info/burrow/evolution_of_snakes.htm http://dinosaurs.about.com/od/otherprehistoriclife/a/Prehistoric-Snakes-The-Story-Of-Snake-Evolution.htm http://www.sciencedaily.com/releases/2008/05/080520203007.htm http://news.softpedia.com/news/The-Evolution-of-the-Snake-Venom-Injecting-Apparatus-41054.shtml http://wellsking.tripod.com/Nathistory.htm http://www.evcforum.net/cgi-bin/dm.cgi?control=msg&m=571539&mlist=on&mbrid=9022
Question
3 answers
ca anybody suggest me a rare genetic disease to do project work on it....plz provide some information about genetic diseases...I need to do research on it...
Relevant answer
Answer
Yes, Xeroderma Pigmentosa is a rare genetic disorder but you have to include most of the rare disorders because you have to more successful options to fine out their causative loci, then genes by identifying mutation. My dear, according to my field and research experience you should include some Alopecia types, Autosomal recessive nonsyndromic hearing loss (Nonsyndromic deafness autosomal recessive), Autosomal Recessive Sensorineural Hearing Impairment and Goiter (Pendred syndrome), Charcot-Marie-Tooth disease, Deafness-retinitis pigmentosa syndrome (Usher syndrome) and some ectodermal dysplasias are also rare. But it depends upon the availability of families with these genetic disorders. It depends upon that In which population you will find out these genetic disorders. Best of luck for nice research with good results.
Question
1 answer
This analysis, at http://www.polygenicpathways.co.uk/alzkegg.htm highlights many pathways relevant to AD (APP processing, apoptosis, oxidative stress etc) but also illustrates a crucial role for many immune related networks and pathogen defence and entry pathways. Disruption of these networks plays a key role in AD pathology
Relevant answer
Answer
Dr Carter. Is there anything known about gene-nutrient interactions with any of these networks? I am thinking specifically of one-carbon metabolites and the potential interaction between C1 genetic polymorphisms and micronutrient deficiencies like folate or vitamin B12.
Question
3 answers
Can anybody explain the LD Plots...any easyway to calculate the LD?
Relevant answer
Answer
LD: The tendency for two 'alleles' to be present on the same chromosome (positive LD), or not to segregate together (negative LD). As a result, specific alleles at two different loci are found together more or less than expected by chance. LD is the nonindependence, at a population level, of the alleles carried at different positions in the genome. In this case, the expected frequency of a two-locus haplotype can be calculated as the probability of the occurrence of two independent (or joint) events simply by multiplying their gene frequencies.
Use Haploview, it is easy and accurate !
Question
8 answers
hello everyone
i want to design a conserved degenerative primer for goose, anyone can help me and tell me how can i do it? which steps shall i follow?
Relevant answer
Answer
thanks a lot
Question
1 answer
Hi, I am Medha from Pune
Relevant answer
Answer
Hello, welcome to the group! :)
Question
2 answers
If there is any thing new toward [cloning and expression of genes] microbial fuel cell let me know.
Relevant answer
Answer
interesting....
Question
1 answer
hi everyone,
I would like to have good information and research paper or article related to marker free selection for identifying transformed cell.
This is really a good and interesting topic to be discussed.
waiting for yours good and valuable response.
Regards.
Relevant answer
Answer
OK2..
I'm waiting for you..
Question
2 answers
Hi
I would like to know the techniques to analyse the level mRNA transcriptional expression in mice.
Is their any good technique to know the level of perticular gene in invio condition.
Relevant answer
Answer
Are you looking for expression levels within a specific tissue? Depending on your budget, RNA-SEQ might be the optimal technique to use since it gives you the ability to measure a wide dynamic range of expression.
Question
5 answers
pls make some of your points clear
1)is the organism the yeast or bacteria from which isolated?
2)do you know its gene sequence? or its upstream or downstream sequence? perhaps no.
3)how r u sure that you isolated the right protein?
4) r u sure that your mass spec was error free?
please respond to these queries which will make others and me comfortable to answer.
Regards
Aditya
Relevant answer
Answer
thank you friend i am waiting for you preicious suggestions.
i am thinking that may be my protein is new discovery and i can call it noval killer toxin what do you think?
Aslam
Question
3 answers
Relevant answer
Answer
How to apply? is there a website ??? How to apply for just attending the workshop ?
Question
1 answer
Do lamarck's theory of adaptation has any validity or acceptance? Or It is the darwin's theory of natural selection that is 100% true and valid.?
Relevant answer
Answer
If an individual uses a particular organ, the organ will become stronger, and if it is not used, the organ will
weaken. The stronger or weaker organ will then be inherited by the offspring. Over time, the organs of these
individuals will be modified due to their use or disuse. If an organ is disused, it may disappear in future
generations io am not able to accept
Help!!!
Question
2 answers
Hi guys, I used 5'FOA to select the URA3 knockout strain of GS115.I want to know which culture medium should I use when I pick the single clone ?Should I use MGY supplemented with uracil and histidine or YPD? Or any oher good choice can take?! regards, Chase
Relevant answer
Answer
hi Janice,thanks for your interest!
Question
1 answer
good gathering
Relevant answer
Answer
Has anybody had any informative research documents about the Armageddon?
Some people write that it will break out in Aleppo, Syria in 2023.
I try to find any research article about that.
Where? When? How? Which countries? etc.
Question
2 answers
I have been conducting research molecular genetic of indonesian sheep
Relevant answer
Answer
For all scientist and researcher in any country
Question
2 answers
I want joint research
Relevant answer
Answer
Welcome for collaborative research project.Send me details about your field of research.With regards.
Question
9 answers
Hi everybody! I am interested in identifying possible binding sites for a transcription factor (binding to CCAAT-box) in certain genes. Do you know how to do it? Thank you!
Relevant answer
Answer
If you want to predict sites for possible binding in the entire upstream region, I suggest using the MatInspector application in Genomatix (1 week free trial). This could help you identify several possible binding sites to focus on for further labwork.